Skip to main content

Table 2 P rimers used for qRT-PCR

From: Branchial NH4+-dependent acid–base transport mechanisms and energy metabolism of squid (Sepioteuthis lessoniana) affected by seawater acidification

Gene name Abbreviation Primer sequence Amplicon size (bp) Accession numbers
Sodium–hydrogen exchanger 3 NHE3 F 5′- GGCTGTCTTCCAAGAAATGGGTGT -3′ 168 KJ451615
R 5′- AAGAACTTGGCAACACCAAGAGCG -3′
Vacuolar-type H + −ATPase VHA F 5′- ACGTGAGGGCAGTGTCAGTATTGT -3′ 161 ADM67602.1
R 5′- TGATCAGCCAGTTGATGGAAGGGA -3′
Na+, K + −ATPase NKA F 5′- CCGTGCTGAATTTAAGGCAGGTCA -3′ 83 GQ153672.1
R 5′- GCAAAGCTGATTCAGAAGCGTCAC -3′
Rhesus protein RhP F 5′-GCACAAAGGAAAGCTGGACATGGT-3′ 179 KJ451616
R 5′-AATGATACCAGCCACCACTCCGA-3′
Sodium-bicarbonate cotransporter NBC F 5′-AATTCGCTGCATGATTGTCCGTCC-3′ 188 HM157263.1
R 5′-TTCCGGAGAACTGACGACCGATTT-3′
Cytosolic Carbonic anhydrase CAc F 5′-GTGAAGCCAACATGGAAGTC-3′ 108 KJ451614
R 5′-GCAGTTTGTAAGGAGTTGTCTC-3′
Reference gene     
Ubiquitin-conjugated enzyme UBC F 5′- ATGCAGATGGCAGTATTTGCCTGG -3′ 127 HM157280.1
R 5′- TTATTGGCTGGGCTGTTTGGGTTC -3′
  1. F, forward primer; R, reverse primer.