Skip to main content
Download PDF

MicroRNA ame-let-7 targets Amdop2 to increase sucrose sensitivity in honey bees (Apis mellifera)

Frontiers in Zoology volume 20, Article number: 41 (2023) Cite this article

Abstract

Background

As an important catecholamine neurotransmitter in invertebrates and vertebrates, dopamine plays multiple roles in the life of the honey bee. Dopamine receptors (DA), which specifically bind to dopamine to activate downstream cascades, have been reported to be involved in honey bee reproduction, division of labour, as well as learning and motor behaviour. However, how dopamine receptors regulate honey bee behavior remains uninvestigated.

Results

The expression level of Amdop2 in the brain increased with the age of worker bees, which was just the opposite trend of ame-let-7. Inhibition of ame-let-7 through feeding an inhibitor upregulated Amdop2 expression; conversely, overexpression of ame-let-7 through a mimic downregulated Amdop2. Moreover, knockdown of Amdop2 in forager brain led to significantly higher sucrose responsiveness, which is similar to the phenotype of overexpression of ame-let-7. Finally, we confirmed that ame-let-7 directly targets Amdop2 in vitro by a luciferase reporter assay.

Conclusions

ame-let-7 is involved in the dopamine receptor signaling pathway to modulate the sucrose sensitivity in honey bees. Specifically, it down-regulates Amdop2, which then induces higher responses to sucrose. These results further unraveled the diverse mechanisms of the dopamine pathway in the regulation of insect behavior.

Background

Dopamine (DA) is an important neurotransmitter that has been strongly implicated in the regulation of locomotor activity, sexual behaviour, development and endocrine function in vertebrates and invertebrates [1]. DA interacts with dopamine receptors, enabling downstream chemical responses. Vertebrates have five subtypes of dopamine receptors: D1-like (D1 and D5) and D2-like (D2, D3 and D4) receptors [2], which have been extensively studied in mammalian brain and spinal cord [1, 2]. There are four subtypes of dopamine receptors in insects: the D1-like dopamine receptor (Dop1), the invertebrate-type dopamine receptors (Dop2), the D2-like dopamine receptor (Dop3) and the DopEcR [3]. Dopamine receptor expressed in mushroom bodies in the fly and Dop1 in the cricket are involved in olfactory learning and memory [4, 5]. DA-Dop1 signalling in the Locusta brain induces gregariousness, whereas DA-Dop2 signalling induces solitariness [6]. In the honey bee (Apis mellifera), DA is associated with reproduction, division of labour, learning, circadian rhythms and sex-specific behaviours [7]. Recent research has reported that DA can induce food craving in the honey bee similar to humans [8].

There are two known types of DA receptors in the honey bee, D1-like receptors, which includes AmDop1, and D2-like receptor AmDop3. Amdop1 and Amdop2 code for G-protein-coupled receptors that, when activated cause increased intracellular levels of cAMP, whereas Amdop3 receptors cause a decrease in cAMP [9, 10]. The expression levels of these three receptors change significantly with age and caste in the brain of bees. Amdop1 has especially low expression levels in 15-day-old bees, Amdop2 levels in the antenna were variable, especially during the first week of adulthood [11]. It is speculated that Amdop3 may curtail the activation of the ovary directly or indirectly through a QMP component homovanillyl alcohol [12]. Amdop3 receptors can be activated by the queen mandibular pheromone (QMP), resulting in blockade of aversive learning of young worker bees [9]. The application of vertebrate D1-like and D2-like receptor blockers in worker bees suggests that dopaminergic receptors could decrease aversive learning in bees [13]. The putative dopamine/ecdysone receptor, Amgpcr19, has high expression levels in seminal vesicles suggesting a possible function in sperm transfer and storage in drones [14, 15]. Knockdown of Amdop2 through injection of dsRNA into the mushroom bodies causes honey bees to spend less time walking but does not affect flying, fanning and upside-down behaviours [16]. Collectively, the functions of DA receptors in honey bees are well studied, but the mechanisms by which DA receptors modulate honey bee behaviors remain unknown.

MicroRNAs (miRNAs) are small (18~24-nucleotide) noncoding, single stranded RNA, which can regulate gene expression by binding complementarily with target mRNA [17]. They play important roles in almost all biological process in eukaryotes [18, 19]. DA-receptors being regulated by miRNAs have been well studied in mammals. For instance, miR-9 regulates the dopamine receptor D2 expression to enhance stress susceptibility and resistance to escitalopram treatment in rats [20]. Overexpression of miR-124 promotes dopamine receptors D1 and D2 and neuronal proliferation and suppresses neuronal apoptosis in rats [21]. MiR-217 activates the dopamine D2 receptor to protect fibrosis in human renal proximal tubule cells [22]. One study suggested that miRNA targets the dopamine receptor involved in progression of endometrial cancer [23]. In contrast to mammals, few studies were conducted on dopamine receptors in insects. Guo et al. (2018) reported that Dop1 inhibited miR-9a to modulate locust olfactory attraction by inducing the dissociation of La protein [24]. However, there was no report about the interaction between dopamine receptor and miRNA in the honey bee.

Proboscis extension response (PER) is a behavior of a honey bee responding by extending her proboscis when a drop of sugar solution is applied to her antennae [25]. The response of honey bees to different concentrations of sucrose can be tested by the PER assay. Responsiveness to sucrose is associated with foraging and collecting-choices. Nurses show weak response to sucrose, while pollen foragers show stronger response to sugar than nectar foragers [26, 27]. In a previous study, nurse brain was shown to have higher expression of ame-let-7 than foragers [28]. Bioinformatic analyses suggested that Amdop2 was the target of ame-let-7. We therefore hypothesized that ame-let-7 regulates Amdop2 which in turn regulates sucrose response in honey bee workers. Because PER to sucrose is higher in foragers than nurses, we also hypothesized that Amdop2 might correlate with behavioral development in honey bees. Specifically Amdop2 should be high in foragers and it should also enhance PER in honey bees.

Materials and methods

Honey bee sample collections

Three European honey bee (Apis mellifera) colonies were maintained according to standard beekeeping practices at the Institute of Zoology, Guangdong Academy of Sciences, Guangzhou, China (23.9325°N, 113.2935°E). One-day-old honey bees were obtained by removing a frame of capped pupae from a typical colony to an incubator (34 °C) until adults emerged. Each one-day-old honey bee was painted with a bee-marking pen and kept in the incubator for an hour before being put back into the original colony. A total of 1000–1500 one-day-old honey bees were marked from each colony. Fifteen worker bees were collected at ages 1, 6, 11, 14, 21, 25 and 30 d (with the day of emergence as day 1), and their brains were dissected immediately and stored at − 80 °C for total RNA extraction. Bees 14 days and older were collected as foragers. Foragers were identified as returning bees with pollen on their corbiculae and captured at the entrance.

Oversupply/inhibition of ame-let-7 in honey bees

A mimic of ame-let-7 with the sense strand (5′ ugagguaguagguuguauagu3′) and the antisense strand (5′ uauacaaccuacuaccucauu3′) including a 2nt-3′ overhang (UU) and 2 nt-5′trim was synthesized by GenPharma (Shanghai, China). An inhibitor (5′ acuauacaaccuacuaccuca3′), a single stranded RNA exactly complementary to ame-let-7 sequence was also synthesized. A mimic control by using nonsense sequence (sense: 5′ uucuccgaacgugucacgutt 3′; antisense: 5′ acgugacacguucggagaatt 3′) and an inhibitor control using nonsense sequence (5′ caguacuuuuguguaguacaa 3′).

To overexpress or inhibit the expression of ame-let-7 in honey bees, 30 foragers (25-day-old) were fed with 3.3 μg mimic of ame-let-7 in 10 μl 50% sucrose solution, another 30 bees were fed with 3.3 μg ame-let-7 inhibitor. The same amount of mimic control sequence (n = 30) or inhibitor control sequence (n = 30) was also fed to foragers as controls. Thus there were four groups of bees, fed either with ame-let-7 mimic (let-7M), or its inhibitor (let-7I), nonsense sequences of mimic (let-7M-NS) and nonsense sequences of inhibitor (let-7I-NS). Foragers were cold-anaesthetized, individually secured in 0.5-ml Eppendorf tubes with a strip of electric tape, and kept in an incubator (28 °C, 70% relative humidity) for at least an hour to recover. The feeding treatments were repeated with foragers from three different colonies. All the foragers were fed to satiety with 50% sucrose solution 3 h after treatments, and kept in an incubator in darkness (28 °C, RH 70%). After 24 h, foragers were tested for sucrose responsiveness using the proboscis extension reflex (PER) assay [30]. Both antennae of foragers were touched with a droplet of ascending concentrations of sucrose: 0.1, 0.3, 1, 3, 10 and 30% (w:w) to test their sucrose responsiveness. Bee brains were dissected immediately after PER for total RNA extraction.

RT-PCR and qRT-PCR analyses

Total RNA was extracted using Trizol (Invitrogen) protocol. The quality and quantity of RNA were determined using a NanoDrop (Thermo Fisher Scientific, Wilmington, DE, USA), before being stored at − 80 °C. Total RNA (1 μg per sample) was reverse-transcribed with mRQ Buffer (2 ×) and mRQ enzyme according to the Mir-X miRNA first-strand synthesis kit (Takara, Japan). The qPCR (quantitative polymerase chain reaction) assays were performed on an ABI StepOnePlus™ Real-Time PCR system. Amplification was carried out in 20 μl reaction volumes, containing 10 μl TB Green Premix Ex Taq II (2 ×), 0.4 μl forward primer (10 μM), 0.4 μl reverse primer (10 μM), 6.2 μl ddH2O, and 3 μl cDNA (0.5 μg). Reaction conditions were 95ºC for 30 s, followed by 40 cycles of 95ºC for 5 s and 60ºC for 30 s, followed by a melting curve (55–95 °C). β-actin and GADPH were used as reference genes for Amdop2, and a small RNA u6 was used as reference gene for ame-let-7. For each gene, test reactions were performed in triplicates. Relative gene expression was calculated using the 2−△△Ct method [31].

RNA interference

To knockdown Amdop2 expression, double stranded RNA (dsRNA) was synthesized using T7-RiboMAXTM Express RNAi System (Promega, USA) according to the manufacturer’s instructions. Thirty foragers were each fed with 10 μl 50% sucrose solution containing 2 μg dsRNA. Another 30 foragers were each fed with the same amount of dsGFP as a control. After 24 h, foragers were tested for sucrose responsiveness using PER assay. Bee brains were dissected immediately after PER. The dissection was done in cold saline following that of Olivier et al. [32]. These brains then immediately extracted for total RNA using the Trizol method. The expression of Amdop2 was analyzed by qPCR as described above. The primers for RNAi were listed in Table 1.

Table 1 Primers used in this study for Amdop2 double-stranded RNA synthesis, reverse-transcription quantitative polymerase chain reaction (RT-qPCR) analyses and construction of luciferase reporter vector
Full size table

Dual luciferase reporter assay

The Amdop2 coding sequence fragments of 420-bp containing ame-let-7 binding sites (Additional file 2: Fig. S1) and its mutant sequence (Amdop2-CR-mut) were synthesized and amplified using 2 × PCR Mix (Takara) (Additional file 1: Table S1), then integrated into a psiCHECK-2 dual-luciferase vector using XhoI and ApaI sites to form the psiCHECK-2-Amdop2-CR-wide-type (Amdop2-CR-wt) or psiCHECK-2-Amdop2-CR-mutant (Amdop2-CR-mut) reporter vector (Table 1). HEK293T Cells (Rochenpharm, China) were seeded at 1 × 106 cells per well in a 12-well plate in the 37 °C incubator. According to the manufacturer’s instructions, cells were co-transfected recombinant psiCHECK-2 luciferase reporter vector with CR of Amdop2 (wt or mut) and ame-let-7 mimics using lipofectamine 2000 (Invitrogen, Thermo Fisher Scientific). The control group was co-transfected with 1 μg recombinant psiCHECK-2 luciferase reporter vector with CR of Amdop2 (or mut) and negative control of mimics (ame-let-7 mimics NS). In all cases, 60 ng miRNA and 60 ng transfer vector were mixed, and 1.5 μg of pCopia-Renilla luciferase was added as an internal control. Twenty-four hours after transfection, luciferase assays were performed using a dual-specific luciferase assay kit (#RG027, Biyuntian, Shanghai, China). Renilla luciferase activity provided normalization for firefly luciferase activity.

Statistical analyses

Statistical analyses were conducted in SPSS 16.0 (SPSS Inc., Chicago, IL, USA). One way analysis of variance (ANOVA) followed by Turkey’s honestly significant difference (HSD) test was used to compare the gene expression of Amdop2 among different aged bees. ANOVA was also used to analyze the data with PER response as a dependent variable, where PER response (%) was analysed after arcsine-square root transformation. Different sugar concentrations were treated as repeated measures. Student’s T-test was used to compare the differences in Amdop2 expression between dsAmdop2 bees and dsGFP bees. All data are presented as the means ± standard errors (SE). A P < 0.05 was considered statistically significant.

Results

Abundance of ame-let-7 and expression patterns of Amdop2 in adult bees

Ame-let-7 abundance was significantly different among bees of different ages (ANOVA, F = 9.18, df = 6,14; P < 0.01). In general, ame-let-7 decreased as the age of honey bees increased, with the abundance significantly lower after day 21 compared to day 1 and day 6 (Fig. 1A). Amdop2 expressions were significantly different among bees of different ages (ANOVA, F = 5.89, df = 6, 13; P < 0.01). In contrast to ame-let-7, HSD tests showed that Amdop2 increased slowly with age of the adult bees, with a significantly higher expression at 21 and 25 days of age, but returned to the very low level at age 30 (Fig. 1B).

Fig. 1
figure 1

Mean (± SE) of ame-let-7 abundance (A) and expression levels of Amdop2 (B) in the brains of different aged worker bees. Workers were collected at 1, 6, 11, 14, 21, 25 and 30 days post-eclosion, with those 14 days or older as foragers which returned home with pollen. Gene levels in different aged bees were analyzed by One-Way ANOVA, followed by post-hoc Turkey test for multiple comparisons (n = 3 for each point, P < 0.05)

Full size image

ame-let-7 regulates the expression of Amdop2 in vivo

Brain ame-let-7 abundance was significantly reduced in foragers after being fed with an inhibitor of ame-let-7 (ame-let-7I) than its control group (ame-let-7I-NS) (t = 10.58, P < 0.01, Fig. 2A), while Amdop2 expression was significantly enhanced in forager brains in the inhibitor-fed (ame-let-7I) group than the control (ame-let-7I-NS) group (t = 2.76, P < 0.05, Fig. 2C). Conversely, brain ame-let-7 abundance was significantly enhanced when bees were fed with an ame-let-7 mimic (ame-let-7M) compared to the control (ame-let-7M-NS) group (t = 5.92, P < 0.05, Fig. 2B); Amdop2 expression showed a significant decrease in foragers, when bees were fed with a mimic of ame-let-7 (ame-let-7M) compared to its control (ame-let-7M-NS) (t = 4.58, p < 0.001, Fig. 2D).

Fig. 2
figure 2

Expression levels of ame-let-7 (A, B) and Amdop2 (C, D) 24 h after being treated with ame-let7 mimic, mimic control, inhibitor and inhibitor control, shown as ame-let-7 M, ame-let-7 M-NS, ame-let-7I and ame-let-7I-NS, respectively. The qPCR data are presented as the mean ± SE (n = 3), ** indicates significant difference at P < 0.01, and * indicates significant difference at P < 0.01 compared with the respective NS (nonsense) groups

Full size image

Confirmation of the interaction of ame-let-7 with Amdop2

When ame-let-7 mimic was co-transfected with dop2-CR-wt in 293 T cells, luciferase activity was significantly decreased compared to the cells co-transfected with dop2-CR-m or the negative control group (F = 105.5, df = 5, 12; P < 0.0001, Fig. 3). None of the NS groups affected luciferase activity.

Fig. 3
figure 3

Co-transfection of psiCHECK2 dop2-CR-wt with ame-let-7 mimic resulted in dramatic suppression of the luciferase activity. A normalization firefly/renilla luciferase value was plotted with ± SE (n = 3 for each point). ** indicates significant difference at P < 0.01 compared with the negative control in ANOVA analysis

Full size image

ame-let-7 affects the sucrose responsiveness in foragers

PER response varied significantly with sugar concentrations (F = 9.30, df = 5, 10; P < 0.01). PER response was significantly higher in bees fed with a mimic (ame-let-7M) compared to the group fed with nonsense control (let-7M-NS) (F = 20.4, df = 1, 5; P < 0.05, Fig. 4). There were no significant interactions between sucrose concentrations and the treatments (F = 0.52, df = 5, 10; P > 0.05).

Fig. 4
figure 4

Mean score (% ± SE) of PER of bees to various sugar concentrations after being treated with a mimic of ame-let-7 or nonsense sequences of mimic. Responsiveness to sucrose was significantly increased by a mimic of ame-let-7, compared with the control. Data from three colonies were analyzed after arsine-square root transformation during ANOVA but presented here without transformation. Each data point represents 30 bees

Full size image

Amdop2 affects sucrose responsiveness in foragers

The expression of Amdop2 was significantly suppressed at 24 h (Student’s T test, t = 3.33; P = 0.0029) (Fig. 5), with a reduction of 50% compared to the control. PER response changed significantly with sugar concentrations (ANOVA, F = 65.07, df = 5, 10; P < 0.001) (Fig. 6). The PER response to sugar in the dsAmdop2-fed bees was significantly enhanced compared to the control group (F = 11.6, df = 1, 5; P < 0.001) (Fig. 6). There were no significant interactions between sucrose concentrations and the treatments (F = 1.49, df = 2, 5; P > 0.05).

Fig. 5
figure 5

Amdop2 expression (means ± SE) in the brains of foragers after being fed with dsAmdop2 or a negative control dsGFP. ** indicates significant difference at P < 0.01 (Student T-test) compared with dsGFP

Full size image
Fig. 6
figure 6

Mean score (% ± SE) of PER of bees to various sugar concentrations after being treated with dsAmdop2 or dsGFP in foragers. Responsiveness to sucrose was significantly (P < 0.01) enhanced in dsAmdop2 bees, compared to the dsGFP control. Data from three colonies were analyzed after arsine-square root transformation during ANOVA but presented here without transformation. Each data point represents 30 bees

Full size image

Discussion

The first major finding of this study is that Amdop2 is regulated by ame-let-7. The notion that Amdop2 was regulated by am-let-7 was supported by several lines of evidence. First there was a reverse relationship between the two (but see below about day 30 data), with am-let-7 decreasing with age and Amdop2 increasing with age (Fig. 1). Furthermore, manipulating ame-let-7 levels with a mimic (overexpression), or an inhibitor (knockdown) caused a reversed directional change in Amdop2 expressions (Fig. 2). Lastly, we show conclusively that Amdop2 is the target of ame-let-7 through a luciferase assay because luciferase activity was significantly decreased when an ame-let-7 mimic was co-transfected with dop2-CR-wt in HEK293T cells compared to control group (Fig. 3).

The second major finding is that Amdop2 down-regulates sucrose responsiveness in honey bees. This was first suggested by ame-let-7 inhibitor significantly reducing PER, presumably because in these bees Amdop2 was increased due to a downregulation in ame-let-7 causing an increase in Amdop2, which was shown earlier (Fig. 2). Conversely, an ame-let-7 mimic significantly enhanced PER presumably because the increase of ame-let-7 caused a decrease in Amdop2, which negatively affected PER (Fig. 4B). A more direct evidence was provided by the RNAi experiment where bees fed with double stranded Amdop2 (dsAmdop2) showed an enhancement in PER (Fig. 6). This was after we showed that the method indeed was working, as shown by Amdop2 being down regulated post dsAmdop2 feeding (Fig. 5).

Our results of foragers with Amdop2 knockdown resulting in enhanced sucrose responsiveness are consistent with other published studies. It has been shown that the injection of dopamine into the thorax significantly decreases responsiveness to sucrose in foragers [35]. In addition, thoracic injection of the dopamine receptor agonist 2-amino-6, 7-dihydroxy-1, 2, 3, 4-tetrahydronaphthalene (6, 7-ADTN) and administration of 6, 7-ADTN also significantly reduces sucrose responsiveness in foragers [33]. Up-regulation of Amdop2 expression results in an increase in dopamine in the central brain of the honey bee, which regulates neuronal sensitivity to dopamine both temporally and spatially [34,35,36]. In the present study, RNAi of Amdop2 in the brains of foragers reduced the number of dopamine receptors, causing an effect similar to decreasing dopamine titre. This decrease then made the foragers more sensitive to sugar, consistent with the increase of dopamine in reducing sucrose responsiveness [33].

It is intriguing that Amdop2 would have a negative effect on PER, given that PER is shown to be higher in foragers than nurses [26, 27] and our first experiment here showing that Amdop2 was higher in foraging-aged bees (21–25 days) compared to younger bees (10 days or younger, Fig. 1). It is possible that the Amdop2 increase we observed here in Fig. 1 was not related to division of labor, but purely due to worker age. This was at least true in antennae Amdop2 expression in nurses and foragers, which showed no differences [11]. Our own data here also suggests there was no tight link between Amdop2 and division of labor because both 14 and 30 day old bees were collected as foragers but showed low levels of Amdop2 (Fig. 1). However, more studies are required to confirm that changes in Amdop2 expression is more as a function of age, rather than due to difference in behaviors.

Several miRNAs have been shown to regulate honey bee behaviors, since the first study by Weaver and colleagues [37]. MiR-932 regulates honey bee memory by targeting actin [38]. MiR-279a regulates forager sugar responsiveness by suppressing Mblk-1 [30, 39]. Previously, we predicted that ame-let-7 would target Amdop2 [29], and determined that ame-let-7 abundance decreased with age in honey bees [28]. Amdop2 expression in the current study showed a reversed trend compared to ame-let-7, with an age-related increase. We hypothesized that Amdop2 could be regulated by miRNA ame-let-7 in the brain which in turn could regulate worker behaviors. As expected, ame-let-7 overexpression significantly inhibited Amdop2 expression in forager brains. Conversely, inhibition of ame-let-7 significantly increased Amdop2 expression in foragers. Moreover, luciferase assay confirmed that ame-let-7 targets the coding region of Amdop2 because transfection of psiCHECK2-dop2-CR reduced the luciferase activity and psiCHECK2-dop2-CR mutant rescued this suppression to the same level as that of the blank control. These results strongly indicate that ame-let-7 directly targets Amdop2.

DA receptors mediate gene expression at transcriptional level through its downstream messenger pathways [40]. The mammalian D1 receptor is activated after coupling with multiple transcription factors, such as zif-268 and jun-b at the mRNA level [41], and the cyclic AMP-response element binding protein at the protein level [42]. Guo et al. (2018) confirmed that DA receptors can also act as post-transcriptional regulator [24]. They reported that Dop1 inhibited miR-9a to modulate locust olfactory attraction by inducing the dissociation of La protein. Their results suggest that combined action at two levels by DA receptor is beneficial for regulating gene expression and for controlling rapid behavioral changes. In the current study, overexpression of ame-let-7 in the forager brains made them more excited, showing stronger sucrose responsiveness compared to the control bees. The observed behavioral phenotype was similar to decreased Amdop2 mRNA expression, this suggests that ame-let-7 regulated the transcripts of Amdop2 to modulate the sugar response of foragers. Taken together, Amdop2 was mediated by DA [2], and may also be regulated by ame-let-7, with lower Amdop2 causing the stronger sugar response of foragers. Our results further confirmed the function of DA receptors at post-transcriptional level. The sugar responsiveness of honey bee correlates with many behavioral parameters such as age of first foraging, pollen vs nectar/water foraging and learning [27, 43]. We found that ame-let-7 targeted Amdop2 to affect foragers’ sugar responsiveness, but it is unclear what behavioral parameters it will impact. Both ame-let-7 and Amdop2 have abundant expression in the honey bee brain [29, 44], which is only 1 mm3 in size, containing 950,000 neurons, and is accessible to recording and manipulation [45]. Whether ame-let-7 would affect the neuron function of bees by targeting Amdop2 should be further explored.

Conclusion

In summary, feeding of dsAmdop2 can significantly decrease the expression of Amdop2 in the brain, which enhanced the sucrose responsiveness of foragers. ame-let-7 directly targets the coding region of Amdop2. Moreover, overexpression of ame-let-7 enhanced the sucrose responsiveness in foragers, which is similar to the effect of decreased Amdop2 in foragers. These findings suggest that ame-let-7 targets Amdop2 to regulate the sucrose responsiveness of foragers, and may play important roles in regulating honey bee behavior.

Availability of data and materials

Not applicable.

References

  1. Macedo-Lima M, Remage-Healey L. Dopamine modulation of motor and sensory cortical plasticity among vertebrates. Integr Comp Biol. 2021;61:316–36.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  2. Bibb JA. Decoding dopamine signaling. Cell. 2005;122:153–5.

    Article  PubMed  CAS  Google Scholar 

  3. Verlinden H. Dopamine signalling in locusts and other insects. Insect Biochem Mol Biol. 2018;97:40–52.

    Article  PubMed  CAS  Google Scholar 

  4. Himmelreich S, Masuho I, Berry JA, MacMullen C, Skamangas NK, Martemyanov KA, Davis RL. Dopamine receptor DAMB signals via Gq to mediate forgetting in Drosophila. Cell Rep. 2017;21:2074–81.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  5. Awata H, Watanabe T, Hamanaka Y, Mito T, Noji S, Mizunami M. Knockout crickets for the study of learning and memory: Dopamine receptor Dop1 mediates aversive but not appetitive reinforcement in crickets. Sci Rep. 2015;5:15885.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  6. Guo X, Ma Z, Kang L. Two dopamine receptors play different roles in phase change of the migratory locust. Front Behav Neurosci. 2015;9:80.

    Article  PubMed  PubMed Central  Google Scholar 

  7. Sasaki K, Watanabe T. Sex-specific regulatory systems for dopamine production in the honey bee. Insects. 2022;13:128.

    Article  PubMed  PubMed Central  Google Scholar 

  8. Huang J, Zhang Z, Feng W, Zhao Y, Aldanondo A, de Brito Sanchez MG, Paoli M, Rolland A, Li Z, Nie H, et al. Food wanting is mediated by transient activation of dopaminergic signaling in the honey bee brain. Science. 2022;376:508–12.

    Article  PubMed  CAS  Google Scholar 

  9. Beggs KT, Mercer AR. Dopamine receptor activation by honey bee queen pheromone. Curr Biol. 2009;19:1206–9.

    Article  PubMed  CAS  Google Scholar 

  10. Clark MC, Baro DJ. Arthropod D2 receptors positively couple with cAMP through the Gi/o protein family. Comp Biochem Physiol B Biochem Mol Biol. 2007;146:9–19.

    Article  PubMed  Google Scholar 

  11. McQuillan HJ, Barron AB, Mercer AR. Age- and behaviour-related changes in the expression of biogenic amine receptor genes in the antennae of honey bees (Apis mellifera). J Comp Physiol A Neuroethol Sens Neural Behav Physiol. 2012;198:753–61.

    Article  PubMed  CAS  Google Scholar 

  12. Vergoz V, Lim J, Oldroyd BP. Biogenic amine receptor gene expression in the ovarian tissue of the honey bee Apis mellifera. Insect Mol Biol. 2012;21:21–9.

    Article  PubMed  CAS  Google Scholar 

  13. Vergoz V, Roussel E, Sandoz JC, Giurfa M. Aversive learning in honeybees revealed by the olfactory conditioning of the sting extension reflex. PLoS ONE. 2007;2:e288.

    Article  PubMed  PubMed Central  Google Scholar 

  14. Srivastava DP, Yu EJ, Kennedy K, Chatwin H, Reale V, Hamon M, Smith T, Evans PD. Rapid, nongenomic responses to ecdysteroids and catecholamines mediated by a novel Drosophila G-protein-coupled receptor. J Neurosci. 2005;25:6145–55.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  15. Matsushima K, Watanabe T, Sasaki K. Functional gene expression of dopamine receptors in the male reproductive organ during sexual maturation in the honey bee (Apis mellifera L.). J Insect Physiol. 2019;112:9–14.

    Article  PubMed  CAS  Google Scholar 

  16. Mustard JA, Pham PM, Smith BH. Modulation of motor behavior by dopamine and the D1-like dopamine receptor AmDOP2 in the honey bee. J Insect Physiol. 2010;56:422–30.

    Article  PubMed  CAS  Google Scholar 

  17. Hill M, Tran N. miRNA interplay: mechanisms and consequences in cancer. Dis Model Mech. 2021;14:dmm047662.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  18. Pu M, Chen J, Tao Z, Miao L, Qi X, Wang Y, Ren J. Regulatory network of miRNA on its target: coordination between transcriptional and post-transcriptional regulation of gene expression. Cell Mol Life Sci. 2019;76:441–51.

    Article  PubMed  CAS  Google Scholar 

  19. Ho PTB, Clark IM, Le LTT. MicroRNA-based diagnosis and therapy. Int J Mol Sci. 2022;23:7167.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  20. Zhang Y, Wang Y, Wang L, Bai M, Zhang X, Zhu X. Dopamine receptor D2 and associated microRNAs are involved in stress susceptibility and resistance to escitalopram treatment. Int J Neuropsychopharmacol. 2015;18:pyv025.

    Article  PubMed  PubMed Central  Google Scholar 

  21. Wang J, Wang W, Zhai H. MicroRNA-124 enhances dopamine receptor expression and neuronal proliferation in mouse models of parkinson’s disease via the hedgehog signaling pathway by targeting EDN2. NeuroImmunoModulation. 2019;26:174–87.

    Article  PubMed  CAS  Google Scholar 

  22. Han F, Konkalmatt P, Chen J, Gildea J, Felder RA, Jose PA, Armando I. MiR-217 mediates the protective effects of the dopamine D2 receptor on fibrosis in human renal proximal tubule cells. Hypertension. 2015;65:1118–25.

    Article  PubMed  CAS  Google Scholar 

  23. Czerwiński M, Bednarska-Czerwińska A, Zmarzły N, Boroń D, Oplawski M, Grabarek BO. miRNAs in the expression regulation of dopamine-related genes and proteins in endometrial cancer. J Clin Med. 2021;10:4939.

    Article  PubMed  PubMed Central  Google Scholar 

  24. Guo X, Ma Z, Du B, Li T, Li W, Xu L, He J, Kang L. Dop1 enhances conspecific olfactory attraction by inhibiting miR-9a maturation in locusts. Nat Commun. 2018;9:1193.

    Article  PubMed  PubMed Central  Google Scholar 

  25. Pankiw T, Page RE Jr. Effect of pheromones, hormones, and handling on sucrose response thresholds of honey bees (Apis mellifera L.). J Comp Physiol A Neuroethol Sens Neural Behav Physiol. 2003;189:675–84.

    Article  PubMed  CAS  Google Scholar 

  26. Scheiner R, Page RE, Erber J. Sucrose responsiveness and behavioral plasticity in honey bees (Apis mellifera). Apidologie. 2004;35:133–42.

    Article  Google Scholar 

  27. Scheiner R, Page RE Jr, Erber J. The effects of genotype, foraging role, and sucrose responsiveness on the tactile learning performance of honey bees (Apis mellifera L.). Neurobiol Learn Mem. 2001;76:138–50.

    Article  PubMed  CAS  Google Scholar 

  28. Shi TF, Liu F, Yu LS, Wang TS, Qi L. Expression levels of three miRNAs in the brain of different day-old workers of Apis mellifera ligustica (Hymenoptera: Apidae). Acta Entomolgica Sinia. 2014;57:1368–74.

    CAS  Google Scholar 

  29. Liu F, Peng W, Li Z, Li W, Li L, Pan J, Zhang S, Miao Y, Chen S, Su S. Next-generation small RNA sequencing for microRNAs profiling in Apis mellifera: comparison between nurses and foragers. Insect Mol Biol. 2012;21:297–303.

    Article  PubMed  CAS  Google Scholar 

  30. Liu F, Wu L, Zhang Y, Li Q, Li L, Huang ZY, Zhao H. Mblk-1 regulates sugar responsiveness in honey bee (Apis mellifera) foragers. Insect Sci. 2022;29:683–90.

    Article  PubMed  CAS  Google Scholar 

  31. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCt method. Methods. 2001;25:402–8.

    Article  PubMed  CAS  Google Scholar 

  32. Olivier V, Massou I, Celle O, Blanchard P, Schurr F, Ribière M, Gauthier M. In situ hybridization assays for localization of the chronic bee paralysis virus in the honey bee (Apis mellifera) brain. J Virol Methods. 2008;153:232–7.

    Article  PubMed  CAS  Google Scholar 

  33. Scheiner R, Plückhahn S, Oney B, Blenau W, Erber J. Behavioural pharmacology of octopamine, tyramine and dopamine in honey bees. Behav Brain Res. 2002;136:545–53.

    Article  PubMed  CAS  Google Scholar 

  34. Taylor DJ, Robinson GE, Logan BJ, Laverty R, Mercer AR. Changes in brain amine levels associated with the morphological and behavioural development of the worker honeybee. J Comp Physiol A. 1992;170:715–21.

    Article  PubMed  CAS  Google Scholar 

  35. Schulz DJ, Robinson GE. Biogenic amines and division of labor in honey bee colonies: behaviorally related changes in the antennal lobes and age-related changes in the mushroom bodies. J Comp Physiol A. 1999;184:481–8.

    Article  PubMed  CAS  Google Scholar 

  36. Wagener-Hulme C, Kuehn JC, Schulz DJ, Robinson GE. Biogenic amines and division of labor in honey bee colonies. J Comp Physiol A. 1999;184:471–9.

    Article  PubMed  CAS  Google Scholar 

  37. Weaver DB, Anzola JM, Evans JD, Reid JG, Reese JT, Childs KL, Zdobnov EM, Samanta MP, Miller J, Elsik CG. Computational and transcriptional evidence for microRNAs in the honey bee genome. Genome Biol. 2007;8:R97.

    Article  PubMed  PubMed Central  Google Scholar 

  38. Cristino AS, Barchuk AR, Freitas FC, Narayanan RK, Biergans SD, Zhao Z, Simoes ZL, Reinhard J, Claudianos C. Neuroligin-associated microRNA-932 targets actin and regulates memory in the honeybee. Nat Commun. 2014;5:5529.

    Article  PubMed  CAS  Google Scholar 

  39. Liu F, Shi T, Yin W, Su X, Qi L, Huang ZY, Zhang S, Yu L. The microRNA ame-miR-279a regulates sucrose responsiveness of forager honey bees (Apis mellifera). Insect Biochem Mol Biol. 2017;90:34–42.

    Article  PubMed  CAS  Google Scholar 

  40. Romanelli R, Williams J, Neve K. Dopamine receptor signaling: intracellular pathways to behavior. In: Neve KA, editor. The dopamine receptors. 2nd ed. New York: Springer; 2010. p. 137–73.

    Chapter  Google Scholar 

  41. Cole AJ, Bhat RV, Patt C, Worley PF, Baraban JM. D1 dopamine receptor activation of multiple transcription factor genes in rat striatum. J Neurochem. 1992;58:1420–6.

    Article  PubMed  CAS  Google Scholar 

  42. Arnauld E, Arsaut J, Demotes-Mainard J. Conditional coupling of striatal dopamine D1 receptor to transcription factors: ontogenic and regional differences in CREB activation. Brain Res Mol Brain Res. 1998;60:127–32.

    Article  PubMed  CAS  Google Scholar 

  43. Scheiner R, Page RE Jr, Erber J. Responsiveness to sucrose affects tactile and olfactory learning in preforaging honey bees of two genetic strains. Behav Brain Res. 2001;120:67–73.

    Article  PubMed  CAS  Google Scholar 

  44. Humphries MA, Mustard JA, Hunter SJ, Mercer A, Ward V, Ebert PR. Invertebrate D2 type dopamine receptor exhibits age-based plasticity of expression in the mushroom bodies of the honeybee brain. J Neurobiol. 2003;55:315–30.

    Article  PubMed  CAS  Google Scholar 

  45. Menzel R. The honeybee as a model for understanding the basis of cognition. Nat Rev Neurosci. 2012;13:758–68.

    Article  PubMed  CAS  Google Scholar 

Download references

Acknowledgements

We thank Xuefeng Zhang, Wenfeng Li and Huafeng Li for their excellent work when helping us with sample preparation. We thank Mengqiu Qu and Xiaoshan Xia for bee fixing, Liangbin Li for help with bee behavioural experiment, and Linyue Lei for qRT-PCR analysis with two references genes.

Funding

This work was supported by the Natural Science Foundation of Guangdong Province (2021A1515010630, 2023A1515030072), GDAS Special Project of Science and Technology Development (2021GDASYL-20210103053), National Science and Technology Planning Project (G2023030044L), China Agriculture Research System (CARS-44-SYZ11).

Author information

Author notes

  1. Fang Liu and Hongxia Zhao contributed equally to this work.

Authors and Affiliations

  1. Guangdong Key Laboratory of Animal Conservation and Resource Utilization, Guangdong Public Laboratory of Wild Animal Conservation and Utilization, Institute of Zoology, Guangdong Academy of Sciences, Guangzhou, 510260, People’s Republic of China

    Fang Liu, Hongxia Zhao, Qiang Li, Lixian Wu & Dainan Cao

  2. Yunnan Academy of Biodiversity, Southwest Forestry University, 650224, Kunming, Yunnan, People’s Republic of China

    Yuan Zhang

  3. Department of Entomology, Michigan State University, East Lansing, MI, 48824, USA

    Zachary Y. Huang

Authors
  1. Fang Liu
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Hongxia Zhao
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Qiang Li
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Lixian Wu
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Dainan Cao
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Yuan Zhang
    View author publications

    You can also search for this author in PubMed Google Scholar

  7. Zachary Y. Huang
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

FL planned the experiments, the reporter assay, data analyses and wrote the manuscript. HXZ and ZYH were involved in experimental design, data analysis and manuscript revision. QL performed RNA extraction, qRT-PCR analysis and RNAi. WY performed fluorescence in situ hybridization, LXW, DNC and YZ performed behavioral experiments.

Corresponding authors

Correspondence to Fang Liu or Zachary Y. Huang.

Ethics declarations

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Additional information

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary Information

Additional file 1: Table S1.

The sequences of pri-miRNA of ame-let-7, Amdop2-CR-wt and Amdop2-CR-mut.

Additional file 2: Fig. S1.

A schematic representation of the principle behind the luciferase assay (A). Sequences of the interaction sites between ame-let-7 and Amdop2. Grey shaded areas indicate canonical 7mer “seed” region that aligns with the target site, Asterisks indicate mutated sites, mutated nucleotide bases are shown in bold. The vertical lines indicate contiguous Watson-Crick pairing (B).

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Liu, F., Zhao, H., Li, Q. et al. MicroRNA ame-let-7 targets Amdop2 to increase sucrose sensitivity in honey bees (Apis mellifera). Front Zool 20, 41 (2023). https://doi.org/10.1186/s12983-023-00519-7

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s12983-023-00519-7

Keywords

Frontiers in Zoology

ISSN: 1742-9994