Skip to main content

Table 2 Genes, accession numbers and primer sequences used for qPCR analysis. Asterisks denote reference genes

From: Temperature and predator-mediated regulation of plasma cortisol and brain gene expression in juvenile brown trout (Salmo trutta)

Gene Accession No. Forward primer Reverse primer
5-HT1Aα AGKD01067361 ATGCTGGTCCTCTACGGGCG CGTGGTTCACCGCGCCGTTT
5-HT1Aβ DY694524 TTGATCATGCGTTCCCAGCCGA AAAGGAATGTAGAACGCGCCGA
AVTR AGKD01053513 ACGGGTTCATCTGCCACAGCA TGACAGTTCTCAATTTCGCTCTGGA
CALM BT057678 TGCTGCAGAGCTGCGTCACG AGCCTCCCGGATCATCTCATCCA
CRF1 NM_001141590 CACACCCACATCCTAGGCTACTCAA TAGCGGGGTTGGAAGGCACCA
CRFR1 AKD01020666 ATCATCCATTGGAACCTGAT ATCCAGAAGAAGTTTGTCAC
CRHBP NM_001173799 TTGAGAAGCGTGCGGTGCGT AGCTGCTCTCGGAAAGTCCCCT
EPD1 NM_001140909 TCTGTGAGGGTGTGGAGCTGGAG TTGGTTGGTTGGTTGGGGCTG
GABARAP NM_001142717 ACTCCCCCTCCTTCCCTCATCCA ATCCCCATCTCGGCGACCCG
GRα GQ179974 TGGCCTGTATCCCCCACTGCC CCGCTGGGCTTGGCTGACG
GRβ NM_001124730.1 ACGACGATGGAGCCGAAC ATGGCTTTGAGCAGGGATAG
GRγ NM_001124482.1 TGGTGGGCTGCTGGATTTCTGC CTCCCTGTCTCCCTCTGTCA
GSR BG934480 CCAGTGATGGCTTTTTTGAACTT CCGGCCCCCACTATGAC
MHC1 AF504021 AATGGATCGCCCCAACGCCA CTGTCGCGTGGCAGGTCACT
MR AGKD01011423 AGCTGGCTGGGAAACAGATGA TCAGGGTGATTTGGTCCTCTATGG
RBP1 NM_001140773.2 GTGGCGGGGCCCTACGCTAT TCCTGTGCCCAGCATGTCGC
β-actin* BG933897 CCAAAGCCAACAGGGAGAAG AGGGACAACACTGCCTGGAT
EF1α* NM_001124339.1 GCAGGAAAAGAACCCAACG AGTTACCAGCAGCTTTCTTCC
  1. 5-HT1Aα serotonin 1a-like receptor; 5-HT1Aβ serotonin 1b-like receptor; AVTR arginine-vasotocin receptor; CALM calmodulin; CRF1 corticotropin-releasing factor 1; CRFR1 corticotropin-releasing factor receptor 1; CRHBP corticotropin-releasing factor binding protein; EPD1 ependymin; GABARAP gamma-aminobutyric acid receptor-associated protein; GRα glucocorticoid receptor; GRβ glucocorticoid receptor 1; GRγ glucocorticoid receptor 2; GSR glutathione reductase; MHC1 major histocompatibility complex 1; MR mineralocorticoid receptor; RBP1 retinol binding protein 1; β-actin β-actin; EF1α elongation factor 1α