Skip to main content

Table 1 Primer sequences for PCR designed from Zebra Finch genome

From: Expression of 5α- and 5β-reductase in spinal cord and muscle of birds with different courtship repertoires

Gene Direction Sequence Amplicon size (bp)
SRD5A1 Forward TTTCACTTTTGTGTTAGCACTTCTG 403
Reverse TGGATAGTCTTCAAATTTCTCAAGG
SRD5A2 Forward CCTTTCTTCACTAGAGGCAGACC 435
Reverse TGGATAGTCCGTAAATGTCTTGAG
SRD5B1 Forward AGAAAACTCCCAAAGGTTCCTG 401
Reverse TGCCAAGCCTGCATCTTTAC