Skip to main content

Table 3 Template specific primers used in this study

From: Environmental monitoring using next generation sequencing: rapid identification of macroinvertebrate bioindicator species

Primer name Sequence (‘5 to 3’) Gene Reference
HCO2198/ 912 TAAACTTCAGGGTGACCAAAAAATCA COI [77]
LCO1490 GGTCAACAAATCATAAAGATATTGG COI [77]
COI A for CCHCGAATAAATAATATAAGWTTYTG COI This study
911 TTTCTACAAATCATAAAGATATTGG COI [78]
CB1 TATGTTTTACCATGAGGACAAATATC CytB [79]
CB322 R GGRTTDGCDGGRATRAARTTATC CytB This study
CB549 R TTCTACDGTDGCHCCAATTCA CytB This study
T-N-S1 TATTTCTTTCTTATGTTTTCAAAAC CytB [79]
  1. Primers were used for Sanger sequencing and in 454 pyrosequencing.