Skip to main content

Table 2 Primer sequences used for quantitative real time PCR gene expression analysis in H reidi

From: Dynamic changes in DNA methylation during seahorse (Hippocampus reidi) postnatal development and settlement

Genes Forward primer sequence (5′-3′) Reverse primer sequence (5′-3′)
dnmt1 CACCACTGTCACCAATCCTG GGTACGTATCGGGGAAACCT
dnmt3b TTTGCGTGCTGAAAGATGTC ACTCCATGGCACTGTTGTTG
18S CGCGAGATTGAGCAATAACA TACTGGGAATTCCTCGTTGG