Skip to main content

Table 1 Primer sequences for real-time PCR

From: Asian house rats may facilitate their invasive success through suppressing brown rats in chronic interaction

Gene Forward Primer 5′–3′ Reverse Primer 5′–3′
GAPDH GACAATGAATATGGCTACAGCAAC TTTATTGATGGTATTCGAGAGAAGG
GR AGGCAGTGTGAAATTGTATCCCAC GAGGCTTACAATCCTCATTCGTGT
BDNF GAAGGGCCAGGTCGATTAGGTG GACGGAAACAGAACGAACAGAA
TrkB GAGACGAAATCCAGCCCCGACAC CACAGACTTCCCTTCCTCCACCG