Skip to main content

Table 2 Species-specific quantitative PCR (qPCR) primers

From: Expression of 5α- and 5β-reductase in spinal cord and muscle of birds with different courtship repertoires

Species Gene Direction Sequence Amplicon size (bp)
Golden-collared Manakin SRD5A1 Forward CCAAGAGGAGGAATGTTTGAG 142
Reverse CCCTTGAACCCAAGATGAAA
SRD5A2 Forward AAGATTCCTCAAGGGGGACTG 132
Reverse GCAAAGAGTGAAAAAGGCAAAG
SRD5B1 Forward TTTACTGTGGCAAGCTGTGG 75
Reverse TCTTCAGTGTCTTCTCCAGTGTG
Zebra Finch SRD5A1 Forward AGGCCGAGCTTACCACCTAT 68
Reverse ACCTGTAATGAAGCGCAAGC
SRD5A2 Forward GGCCTCCTCTTATTTCTGCTG 108
Reverse TCCTCCTTGGGGAATCTTG
SRD5B1 Forward CTTTCAAGCCTGGAGATGCAC 83
Reverse CCAAGTGGCACATAAGTCTGTC