Skip to main content

Table 2 Primer sequences used for quantitative real-time PCR

From: Roles of ecdysteroids for progression of reproductive cycle in the fresh water crustacean Daphnia magna

Genes Forward Reverse
cyclophilin GACTTTCCACCAGTGCCATT AACTTTCCATCGCATCATCC
neverland 1 AGCACAAGGCGGGAAGAGT GCTTCCCATTTCACCTTCCA
neverland 2 CGTCGGTGACTGCATCGA TGCCGTCGTTCCCATTG
shade GACTGCTGAAGGCGTTGACA CGGCTGCCACTAGGTCGATA
Cyp18a1 TACCCGATCGTCGGTTACCT GAGCGCCGTCAGCTCTTC
EcR common region GAGGCGCTGCAGGCTTAC GAGTTTGGCAAACTCCGTCATC
USP GTTGGAGTCAAGGATGGTATCGT AGCCGAGTTCCGGTGGAT