Skip to main content

Table 1 Primer sequences used for gene cloning

From: Roles of ecdysteroids for progression of reproductive cycle in the fresh water crustacean Daphnia magna

Genes Forward Reverse
neverland 1 ATGGATGTCTTTTTCGTTTTCAAATCC GGTGTAACCGTCTCGAAG
neverland 2 GGACGCGTATTGCCCTCATTTGGGA TAATCCCGGCCCGATTTGTTTGGCT
Cyp18a1 ATGATCGTGTGGAGTTTGGGA TTTGGCGTTCTGGATCTCCAG
3′ RACE  
neverland 1 GCCTCCATCATGAACTACGCCTATTCGG
Cyp18a1 GCGACGGCCGTGAGAAAATGGAG
GCCGTTCACATGAACCCTGCCTTGC