Skip to main content

Table 2 Primers used in PCR reactions.

From: Functional chloroplasts in metazoan cells - a unique evolutionary strategy in animal life

gene primer name sequence 5' → 3' origin
16S    
  16Sar-5' CGCCTGTTTATCAAAAACAT [101]
  16Sbr-3' CCGGTCTGAACTCAGATCACGT [101]
coxI    
  LCO1490 GGT CAA CAA ATC ATA AAG ATA TTG G [60] after Folmer et al. 1994
  HCO2198 TAA ACT TCA GGG TGA CCA AAA AAT CA [60] after Folmer et al. 1994
28S    
  28SC1 ACC CGC TGA ATT TAA GCA T [102]
  28SD3 GAC GAT CGA TTT GCA CGT CA [102]
  28SC2F(C2')* GAA AAG AAC TTT GAA GAG AGA GT [102]
  28SD2F CCC GTC TTG AAA CAC GGA CCA AGG [102]
  28SD2R CCT TGG TCC GTG TTT CAA GAC GGG [102]
  28SC2R(C2)* ACT CTC TCT TCA AAG TTC TTT TC [102]
  28SF2 GAGAGAGTTCAAGAGTACG [103]
  28SR3 CTCAGGCATAGTTCACCATC [103]
  28SF3 CGAAACCCAAAGGCGCAGTGA [103]
  28SR1 AGCGCCATCCATTTTCAGGG [103]