Skip to main content

Table 1 Summary of parameters for qPCR genes studied.

From: Phasing of muscle gene expression with fasting-induced recovery growth in Atlantic salmon

Gene Primer 5'-3' Prod. size (bp) Tm (°C) E (%) R2 Accession number
IGF-I f:CCTGTTCGCTAAATCTCACTTC 226 80.3 100.3 0.998 EF432852
  r:TACAGCACATCGCACTCTTGA      
Myogenin f:GTGGAGATCCTGAGGAGTGC 146 84.5 95 0.993 DQ294029
  r:CTCACTCGACGACGAGACC      
MyoD1a f;CCAAATAGTTCCAGACGCAAG 104 79.8 102.1 0.999 AJ557148
  r:ACAGCGGGACAGGCAGAGG      
MEF2A f:ACCGGCTACAACACCGAGTA 121 84.1 92.5 0.994 DY713536
  r:CCTGGCCCAGTTGATGTT      
MuRF1 f:AGGCGGGATCAGAGCTAAC 229 87.2 103.7 0.998 DN165465
  r:CGACCATTCCAAAGTCCATC      
MAFbx f:AAAGGAAGCACTAAAGAGCGTC 137 83.6 97.2 0.996 DN165813
  r:CTGGGACTTGGCAATGAGC      
Pkm f:GTGACCATGATGCACTCGATC 225 84.6 100.3 0.992 CK888371
  r:GGACAGCGTGGGCGATAC      
Pgk f:CTCGGTGATGGGGCTTAGG 160 82.6 92.1 0.996 DN166327
  r:TCATTGGTGGAGGCGACA      
TALDO1 f:AGGTAGACGCCAGGCTTTC 125 82.4 99 0.994 EG912503
  r:CCATGTTGAGGAGAGCTTGA      
FBP1 f:TGGGATTGCCAACCTCTATG 153 81.3 96.9 0.996 EG896159
  r:GCCCTCTCGTTCTCCTCTG      
ALDOB f:TCCGTGACCTCCTGTTCTCT 159 83.5 102.1 0.998 AF067796
  r:CTGTGCCTTTGTCCACCTTA      
CrebA f:GGAGTCTGTTTCGCTAAGTCG 168 84.1 100.1 0.998 CU073780
  r:CGTAGGACCGCTGGATGT      
LPL f:TGCTGGTAGCGGAGAAAGACAT 114 80.8 95.9 0.998 BI468076
  r:CTGACCACCAGGAAGACACCAT      
ADIPOQ f:CCAGCCAGAAGGCAATGTAT 192 81.2 98.6 0.996 EG776984
  r:CACCAACGACTCCACCTTC      
MHC f:GCACGCCACTGAAAAC 209 84.1 94.2 0.996 DN164736
  r:CCTCAAGGTCGTCCACT      
DGAT1 f:CATGCTGGAGGTGATG 222 80.1 96.5 0.998 DW564359
  r:GGAAGCACAGTGTGACTGA      
MLC2 f:TCAACTTCACCGTCTTCCTCAC 194 82.6 98.5 0.994 NM_001123716
  r:GCCCACAGGTTCTTCATCTCC      
EF1-α fATCGGCTATGCCTGGTGAC 141 85 96.3 0.999 BG933853
  r:ATGATGACCTGAGCGGTG      
B-actin fACCCAGATCATGTTTGAGACC 146 82.9 92.7 0.997 G933897
  r:TCGTAGATGGGTACTGTGTGGG      
RNA pol II f:TACATGACCAAATATGAAAGG 157 84.5 94.6 0.998 BG936649
  r:GATGATGGGGATCTTCCTGC      
HPRT1 f:CCTCAAGAGCTACTGTAAT 255 80.8 93.6 0.997 EG866745
  r:TCTGGAACCTCAAACCCTATG      
18S f:GCGTCCAACTTCTTA 189 85.7 95.3 0.998 AJ427629
  r:CAATCCCCAATCCCTATC      
  1. Forward and reverse primer sequences (5'-3'), amplicon product size in base pairs (bp), melting temperature of amplicon (Tm), PCR efficiency (E), regression analysis of plasmid dilution series (R2) and accession numbers for genes used in qPCR.