Skip to main content

Table 3 Genes analyzed by quantitative real time RT-PCR.

From: Comparative analysis of septic injury-inducible genes in phylogenetically distant model organisms of regeneration and stem cell research, the planarian Schmidtea mediterranea and the cnidarian Hydra vulgaris

Gene accession number Forward primer 5'-3' Reverse primer 5'-3'
18S rRNA EG412600 ATGGTTGCAAAGCTGAAACT TCCCGTGTTGAGTCAAATTA
HMG EE666986 CGCATCTGATCCATGCAAGC TGTACCTCCCCCGATTGTTCC
Calreticulin EG417940 CCCTTGGGTGCATCCAGAAA CGGACTTCACCTGCCACAGA
Hsp20 DN302574 GGAATCTGGGGTGAGCTTGG CGGTTGATGGCTCAATGCAC
MMP AY068367 TCGGCTTCTGGTTCCGATGT CGGGCAAAAGCTGCAGAACT
Perforin DN307006 GGCTGCCTGCATCTGTTTGA TTGAGCCGTAGTCCGCCAAT
Tubulin DN315207 TCCGGGTGGAGATTTGGCTA GCACGCTTGGCATACATTAGGTC
Actin EC386294 ATCCTGGCATTGCTGATCGT TGGGGGAGCAACAATCTTGA