Skip to main content

Table 1 28S PCR primers used in this study.

From: Blocking primers to enhance PCR amplification of rare sequences in mixed samples – a case study on prey DNA in Antarctic krill stomachs

Primer name Sequence (5' → 3')
Short28SF GTGTAACAACTCACCTGCCG
Short28SR GCTACTACCACCAAGATCTG
Short28SseqF AGCAGGACGGTGGYCATGGAAGTCG
Short28SseqR GCACTGGGCAGAAATCACATTGCG
28S-ElArKrill-3'c3 GTTGGGGCAGTAACGGCCCTTGCGGG3
Short28SR-blkKrill-3'c3 CCACCAAGATCTGCACTAGCGGCGG3
Short28SF-DPO-blkKrill CCTGCCGAAGCAACTAGCCCTGAAAATGGATG
GCGCTCAAGCGTCCTC44444ACTCGACCGTTG3
  4 = dInosine; 3 = C3spacer