Skip to main content

Table 1 COI primers used in this study

From: A new versatile primer set targeting a short fragment of the mitochondrial COI region for metabarcoding metazoan diversity: application for characterizing coral reef fish gut contents

Primer label Sequence (5' - 3') Reference
LCO1490 GGTCAACAAATCATAAAGATATTGG [30]
HCO2198 TAAACTTCAGGGTGACCAAAAAATCA [30]
dgLCO1490 GGTCAACAAATCATAAAGAYATYGG [31]
dgHCO2198 TAAACTTCAGGGTGACCAAARAAYCA [31]
jgLCO1490 TITCIACIAAYCAYAARGAYATTGG [34]
jgHCO2198 TAIACYTCIGGRTGICCRAARAAYCA [34]
Uni-MinibarF1 CAAAATCATAATGAAGGCATGAGC [17]
Uni-MinibarR1 TCCACTAATCACAARGATATTGGTAC [17]
mlCOIintF GGWACWGGWTGAACWGTWTAYCCYCC herein
mlCOIintR GGRGGRTASACSGTTCASCCSGTSCC herein